Zoology
211; Fall, 1996
Z. Liu & W. J. Higgins, Round
III
| Circle your laboratorymeeting time: | MON TUES WED THUR FRI |
| OR | morn morn morn morn morn |
| NO LAB | aftern aftern aftern aftern aftern |
| nite nite nite |
DIRECTIONS:
| 1. | PRINT YOUR NAME on each and every page of the examination NOW! Remember to answer the questions in pen if you wish the right to a regrade request. |
| 2. | You must confine your answers to the spaces provided. No exceptions. We don't have time to hunt. |
| 3. | You must remain seated until we have collected the examinations. We will make the first collection from those who are finished and wish to leave at 12:40 PM. Everyone else will remain seated until 12:50 PM. |
| 4. | Answer the question that is asked. Be specific and concise! |
| 5. | Read the third in this year's series of deathless quotes ad begin: |
"One hundred percent of the shots you don't take don't go in"
- Wayne Gretzky, Hockey Player
SCOREBOARD
|
PAGE |
HIGGINS/LIU POINTS |
VISITOR'S POINTS |
|
2 |
16 |
____________ |
|
3 |
16 |
____________ |
|
4 |
18 |
____________ |
|
5 |
18 |
____________ |
|
6 |
15 |
____________ |
|
7 |
11 |
____________ |
|
FREEBIE |
06 |
_____6______ |
|
TOTAL = |
100 |
____________ |
1a. Supply the data curve for the following plot, remembering
that Cco = the [tubulin] at
which Cc+
- Cc- > 0.
b. List FOUR (4) conditions that will decrease the slope of this plot and shift it to the right:
1.__________________________________ 2.__________________________________
3.__________________________________
4.__________________________________
2. Draw cytoplasmic dynein or kinesin, labeling the important
functional features of the molecule:
* Which molecule are you
drawing? _____________________
* The molecule you have
drawn is responsible for which type of axonal transport?_____________
3. Complete the following graphs for a striated,
skeletal muscle:
5. Explain the structural and chemical bases
for the phenomenon of rigor mortis:
6. Muscle contraction is dependent upon intracellular [Ca2+].
a. Describe how Ca2+ regulates
contraction in striated muscle:
b. Describe ONE of the two mechanisms by which
Ca2+ regulates contraction of
smooth muscle:
7. Given a eukaryotic mRNA sequence:
5' GGUCAUGGGCAUCAGCCCUUAGAA 3'
a. What is the peptide sequence when this is translated (refer to the attached table of genetic code)?
___________________________________________________________________________
b. If the nucleotide A is inserted at the
11th position, (see below for new sequence),
what is the sequence of this translated peptide?
5' GGUCAUGGGCAAUCAGCCCUUAGAA
3'
__________________________________________________________________________
What kind of mutation is this called?
____________________________________________
8c. Draw
a diagram of translational initiation complex. (1)
Label and write out the actual base pairing between the START codon of
mRNA and the anticodon of the corresponding tRNA. (2)
Label 5' and 3' of both the mRNA and the tRNA. (3)
Indicate the A (amino acid), P (peptide) and E (exit) sites on the ribosomal
subunit.Do not include initiation factors.
d. List all the important steps by which this peptide is made and then sorted to Lysosomes. Indicate where in the cell each step takes place. (Step 1 is done for you.))
Step 1: mRNA coding for this peptide is transcribed in nucleus.
Step 2: ___________________________________________________________________
Step 3: ___________________________________________________________________
Step 4: ___________________________________________________________________
Step 5:
___________________________________________________________________
9. Briefly
explain: (1) chemical composition, (2) subcellular location, and(3) function
of:
| Structure | Chemical Composition | Subcellular Location | Function |
| Spliceosome | SnRNA + Protein | ||
| Prokaryotic Ribosome |
|
||
| Clathrin | Coated
Pit
|
||
| Chromatin |
Packaged genetic information |
||
| Nuclear Lamina |
|
10. Select the correct answer(s) for each of the
statements below. There may be more than one correct answer:
a. Central dogma describes the information flow from
(1) RNA ->RNA->Protein, (2) DNA->RNA->Protein,
(3) Protein->DNA->RNA.
_________
b. These properties do NOT apply to genetic codes
(1) Degenerate, (2) overlapping, (3) triplets, (4) universal in all organisms.
_________
c. RNA is transcribed from
(1) 3' to 5' direction, (2) 5' to 3' direction, (3) 5' to 5' direction,
(4) none of the choice.
_________
d. Wobble describes the sloppy base pairing between
(1) tRNA anticodon and mRNA codon (2) DNA replication,
(3) mRNA transcription.
_________
e. Aminoacyl-tRNA-synthetase uses the following as its energy source
(1) ATP, (2) GTP, (3) cAMP, (4) none of the choices
_________
f. snRNP is involved in
(1) protein synthesis,
(2) RNA processing, (3) DNA replication.
_________
g. Nucleolus is the site for
(1) protein synthesis,
(2) rRNA synthesis; (3) ribosome assembly.
_________
(1) phagocytosis, (2) diffusion across plasma membrane
(3) receptor-mediated
endocytosis.
_________
i. Smooth ER is involved in
1) protein synthesis
(2) lipid/steroid synthesis (3) transcription.
_________
j. Which of the following are found in intercalated disks?
1) tight junctions 2) gap junctions 3) coated pits
_________
11. Consider the nuclear pore complex (NPC)
a. Name ONE component of the NPC ________________________________
b. Proteins less
than ___________kD can enter without the addition of ATP.
12. Name TWO proteins involved in co-translational import:
_____________________________________
and ____________________________