Zoology 211; Fall, 1996 Z. Liu & W. J. Higgins, Round III 
 

Circle your laboratorymeeting time: MON TUES WED THUR FRI
OR morn morn morn morn morn
NO LAB  aftern aftern aftern aftern aftern
  nite nite nite 

DIRECTIONS:
 

1.  PRINT YOUR NAME on each and every page of the examination NOW! Remember to answer the questions in pen if you wish the right to a regrade request.
2.  You must confine your answers to the spaces provided. No exceptions. We don't have time to hunt.
3.  You must remain seated until we have collected the examinations. We will make the first collection from those who are finished and wish to leave at 12:40 PM. Everyone else will remain seated until 12:50 PM.
4.  Answer the question that is asked. Be specific and concise!
5.  Read the third in this year's series of deathless quotes ad begin:


 
 

"One hundred percent of the shots you don't take don't go in"

- Wayne Gretzky, Hockey Player




SCOREBOARD

PAGE

HIGGINS/LIU POINTS 

VISITOR'S POINTS

2

16

____________

3

16

____________

4

18

____________

5

18

____________

6

15

____________

7

11

____________

FREEBIE

06

_____6______

TOTAL   =

100

____________


1a. Supply the data curve for the following plot, remembering that Cco = the [tubulin] at which       Cc+ - Cc- > 0.
 
 

b.   List FOUR (4) conditions that will decrease the slope of this plot and shift it to the right: 

      1.__________________________________       2.__________________________________ 

      3.__________________________________       4.__________________________________
 
 
2.   Draw cytoplasmic dynein or kinesin, labeling the important functional features of the molecule: 

      * Which molecule are you drawing? _____________________

 
 
 
 
 
 
 

      * The molecule you have drawn is responsible for which type of axonal transport?_____________
 
 

3.   Complete the following graphs for a striated, skeletal muscle:
 
 


 

5.   Explain the structural and chemical bases for the phenomenon of rigor mortis:
 
 
 
 
 
 

6.   Muscle contraction is dependent upon intracellular [Ca2+].  

a.   Describe how Ca2+ regulates contraction in striated muscle:
 
 
 
 
 
 
 

b.   Describe ONE of the two mechanisms by which Ca2+ regulates contraction of smooth muscle:
 
 
 
 
 
 
 
 

7.    Given a eukaryotic mRNA sequence: 

                        5' GGUCAUGGGCAUCAGCCCUUAGAA 3' 

    a. What is the peptide sequence when this is translated (refer to the attached table of genetic code)? 

        ___________________________________________________________________________
 
      b.  If the nucleotide A is inserted at the 11th position, (see below for new sequence), what is the sequence of this translated peptide? 

       5' GGUCAUGGGCAAUCAGCCCUUAGAA 3'
 

        __________________________________________________________________________
 
 

        What kind of mutation is this called?

         ____________________________________________
 
 
 

8c. Draw a diagram of translational initiation complex. (1) Label and write out the actual base pairing between the START codon of mRNA and the anticodon of the corresponding tRNA. (2) Label 5' and 3' of both the mRNA and the tRNA. (3) Indicate the A (amino acid), P (peptide) and E (exit) sites on the ribosomal subunit.Do not include initiation factors.
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

d.    List all the important steps by which this peptide is made and then sorted to Lysosomes. Indicate where in the cell each step takes place. (Step 1 is done for you.)

Step 1: mRNA coding for this peptide is transcribed in nucleus. 

Step 2:            ___________________________________________________________________ 

Step 3:            ___________________________________________________________________ 

Step 4:            ___________________________________________________________________ 

Step 5:            ___________________________________________________________________
 
 
 

9.         Briefly explain: (1) chemical composition, (2) subcellular location, and(3) function of:
 
 

Structure Chemical  Composition Subcellular  Location Function
Spliceosome SnRNA + Protein        
Prokaryotic Ribosome  
 
 
 
 
 
 
 
   
Clathrin   Coated Pit
 
 

 

 
Chromatin      
Packaged genetic information
 
Nuclear Lamina      
 
 
 
 
 
 

 

10.  Select the correct answer(s) for each of the statements below. There may be more than one correct answer:
 

a. Central dogma describes the information flow from

       (1) RNA ->RNA->Protein, (2) DNA->RNA->Protein,

       (3) Protein->DNA->RNA.

       _________
 
 

b. These properties do NOT apply to genetic codes

       (1) Degenerate, (2) overlapping, (3) triplets, (4) universal in all organisms.  

       _________

c. RNA is transcribed from  

       (1) 3' to 5' direction, (2) 5' to 3' direction, (3) 5' to 5' direction,

       (4) none of the choice.

       _________
 

d. Wobble describes the sloppy base pairing between

       (1) tRNA anticodon and mRNA codon (2) DNA replication,

       (3) mRNA transcription.
 

       _________
 

e. Aminoacyl-tRNA-synthetase uses the following as its energy source

       (1) ATP, (2) GTP, (3) cAMP, (4) none of the choices  

       _________  

f. snRNP is involved in

       (1) protein synthesis, (2) RNA processing, (3) DNA replication.
 

       _________
 

g. Nucleolus is the site for

       (1) protein synthesis, (2) rRNA synthesis; (3) ribosome assembly.
 

       _________  

       (1) phagocytosis, (2) diffusion across plasma membrane

       (3) receptor-mediated endocytosis.
 

       _________  

i. Smooth ER is involved in

       1) protein synthesis (2) lipid/steroid synthesis (3) transcription.
 

       _________
 

j. Which of the following are found in intercalated disks?

       1) tight junctions 2) gap junctions 3) coated pits

      _________
 

11.  Consider the nuclear pore complex (NPC) 

       a. Name ONE component of the NPC   ________________________________ 

       b. Proteins less than ___________kD can enter without the addition of ATP.
 
 

12.  Name TWO proteins involved in co-translational import:


       _____________________________________ and ____________________________